|
|
|
|
Scientific StudiesScientific Studies 2009
DĚDIČ, P. – KRÉDL, Z. – POKORNÝ, R. – PTÁČEK, J. The basic variant of ELISA (double-antibody sandwich – DAS) was in a number of experiments compared with a shorter one utilizing joint application and incubation of antigenes (evaluated sap) and enzyme conjugated antibodies (two step – TS or cocktail) ELISA. Besides speeding-up of the tests, lower material costs and labour demand at the TS ELISA, contrary to DAS ELISA the higher sensitivity of detection was also proved. Higher sensitivity of this modified ELISA procedure could be utilized for more reliable detection of PLRV also in materials with lower virus concentration. TS ELISA; sensitivity and reliability; greenhouse and field-grown plants; tubers Corresponding author: KRÉDL, Z. – DĚDIČ, P. – POKORNÝ, R. The detectability of potato leafroll virus (PLRV) in greenhouse- and field-grown plants as well as in tubers was compared using DAS ELISA at seven potato cultivars with higher infestation of this virus. The conventional post harvest greenhouse indexation was in this way verified by evaluation of field-grown plants using the rest of original tubers. The greenhouse plants as well as field-grown plants were evaluated in two successive terms with statistical assessment both the frequencies of positive findings and extinction values in ELISA. The detailed comparison revealed, in spite of some underestimation of PLRV in greenhouse comparing to occurrence of infected plants in the field that these differences are not statistically significant. The best results achieved in the second term of field evaluation are connected also with higher concentration of this virus in older plants. Laboratory diagnosis of PLRV by DAS ELISA using directly tuber flesh from rose as well as from heel end was not satisfactory. The main reason seems to be lower virus concentration in tuber flesh after long lasting storage at lower temperature. potato; PLRV; DAS ELISA; diagnosis; tubers; greenhouse and field-grown plants Corresponding author: PTÁČEK,
J. – DĚDIČ, P. Fifty-five isolates of PLRV from in-vitro collection (PRI Havlíčkův Brod) were tested by means of RT-PCR and qRT-PCR. The various techniques of RNA isolations were used and compared. The best results (RT-PCR) were achieved with the set of primers according to SOLIMAN et al. (2002). Three sets of oligonucleotide primers and TaqMan probes were designed for the detection of PLRV by means of qRT-PCR. The best results (qRT-PCR) were achieved with the L3 set of primers. The two step qRT-PCR was used, the DNA was labelled by SYBR Green or TaqMan probes. All PLRV isolates tested were detected with the molecular techniques, the results of qRT-PCR and RT-PCR were compared with ELISA. potatoes; PLRV; RT-PCR; qRT-PCR Corresponding author: GREPLOVÁ, M. – POLZEROVÁ, H. The somatic hybrid plants (SH) originated from protoplast fusions firstly between diploid S. bulbocastanum 8003 (blb 8003, 2n=2x=24) and dihaploid S. tuberosum 243 (dh tbr 243; tbr cv. Karin × S. phureja) and secondly between diploid S. pinnatisectum 8166 (pnt 8166, 2n=2x=24) and S. tuberosum cv. Bintje (tbr cv. Bintje). Agronomic traits were analysed, namely the development of plants during vegetation, attack by Phytophthora infestans and Leptinotarsa decemlineata, tuber yield, tuber number, tuber type and general appearance of the tubers. The differences between somatic hybrids blb 8003 + tbr dh 243 were significant in terms of sprouting time, set of tubers and yield between somatic hybrids and tbr parent. In the second group pnt 8166 + tbr cv. Bintje, no significant differences for evaluated traits were found. Assessment of habitus and resistance in somatic hybrids of a combination blb 8003 + tbr dh 243 was very limited by late sprouting. In somatic hybrids pnt 8166 + tbr cv. Bintje attack by Colorado potato beetle was recorded but moderate increase in resistance to late blight was found. Solanum tuberosum; Solanum bulbocastanum; Solanum pinnatisectum;somatic hybrid Corresponding
author: GREPLOVÁ, M. – POLZEROVÁ, H. – KREUZ, L. The protoplasts of S. bulbocastanum PI 243345 (+) S. tuberosum cv. Korneta were electrofused. This experiment offered organogenic calli. 102 plants were harvested and 38 were confirmed as somatic hybrids by flow-cytometry and RAPD. In spite of highly successful hybridization process, the hybrids were slow growing and rooting and they had morphological anomalies. The reasons for these appearances are discussed. plant morphology; potato; somatic hybrid; wild species Corresponding
author: SEDLÁKOVÁ, V. – SEDLÁK, P. –
VEJL, P. – DOMKÁŘOVÁ, J. – HORÁČKOVÁ, V. – HEJTMÁNKOVÁ, K. – PIVEC, V. –
MAZÁKOVÁ, J. – SUCHÁNKOVÁ, P. Twenty-seven
somatic hybrids of double-haploid Solanum tuberosum ssp. tuberosum andSolanum bulbocastanum were made by protoplasts fusion in electric
field. There were important morphological, physiological, cytological and
biochemical characters of these hybrids evaluated in our experiments. Somatic
hybrids showed more intensive development and growth than parental clones and
many intermediary characters. The resistance to Phytophthora infestans
was evaluated by leaf discs method and in conditions of natural pathogen
treatment in one-year experiment in location of Prague. Results inform about
high level field resistance of hybrids. In laboratory experiments, the
resistance level against races virulent to all Solanum demissum derived
genes was from intermediate to high. All hybrids were tuber bearing. Tubers
obtained amount of both glycoalkaloids solanin and chaconin in amount
comparable to parental double-haploid potato. In three hybrids, the limit of somatic hybrid; Solanum; Phytophthora infestans; potato breeding; protoplasts fusion Corresponding author: HORÁČKOVÁ, V. – DĚDIČ, P. – PTÁČEK, J.– KREUZ, L. The paper summarizes data about the structure and long-term maintenance of genetically modified potato lines in the in vitro collections. There is specified concrete use of material in realization of research projects focused on genetically modified potato in the Potato Research Institute Havlíčkův Brod. potatoes; GMO; GM potatoes; in vitro long-term culture Corresponding author: KREUZ, L. – DOMKÁŘOVÁ. J. –
HORÁČKOVÁ V. The endoparasitic cyst nematodes Globodera sp. cause serious worldwide damage in potato cultivation. In the past, several resistance genes from related potato species to potato varieties were introgressed. Understanding the molecular basis of resistance will elucidate interaction of plant-pathogen and assist in breeding of new resistant cultivars. The aim of our work was testing of new markers in set of 157 genotypes. The dominant gene Gro1 located on chomosome VII provides resistance against all known pathotypes of G. rostochiensis. Locus Grp1 localized on chromosome V confers resistance to G. rostochiensis pathotype Ro5 and G. pallida pathotype Pa2 and Pa3. Results obtained from DNA analysis almost correlated with phenotypic expression and the EPCD data. Solanum tuberosum; Synchytrium endobioticum; potato wart disease; DNA marker; potato Corresponding author: POLZEROVÁ, H. – GREPLOVÁ, M. – MAZÁKOVÁ, J. This paper assesses the efficacy of the Petri dish test for confirming resistance to Phytophthora infestansand compares the results with the Laboratory assay of VLEESHOUWERS et al. (1999). Significant differences were found in lesion growth rates (LGR) and infection efficiency (IE) values between resistance tests. Higher infection rate and greater variability were measured using the Petri dish test for tested genotypes. The Petri dish test results correlated significantly with the Laboratory assay. The value of the five day testing in the Petri dish was also shown. Genotypes with a high level of relative resistance to P. infestans were revealed in the tested group using both Petri dish test and Laboratory assay. Overall, the Petri dish test is suitable for the testing and selection of breeding materials, especially somatic hybrids. late blight; leaflet; resistance; Solanum;somatic hybrid Corresponding
author: KREJZAR, V. –
PÁNKOVÁ, I. – KŮDELA, V. – HAUSVATER, E. – DOLEŽAL, P. The resistance of potato cultivar to soft rot caused by three soft-rot Erwinia (=Pectobacterium) species and two pectolytic Pseudomonas species was assessed in tuber slice test. Of 134 potato cultivars and selections, cv. Berber was resistant to Erwinia carotovora subsp. carotovora and cv. Verona was resistant to E. chrysanthemi. Other cultivars tested were low susceptible (0 - 12 cultivars), susceptible (65 - 79) and highly susceptible (39 - 56) to tree soft rot Erwinia. On the other hand, of 134 cultivars and selection tested, 39 were resistant, 63 low susceptible, 30 susceptible and only 2 highly susceptible to Pseudomonas viridiflava. The ability of P. marginalis pv. marginalis to macerate potato tuber tissue was relatively low. Of the 134 cultivars and selections tested, 122 were resistant, 12 low resistant and none were susceptible and very susceptible to P. margialis pv. marginalis. soft rot; Erwinia carotovora subsp. atroseptica; E. c. subsp. carotovora; E. chrysanthemi; Pseudomonas marginalis; P. viridiflava; resistance; potatoes; Corresponding author: HAMOUZ, K. – LACHMAN, J. – ČEPL, J. – DVOŘÁK, P. – ORSÁK, M. – ČÍŽEK, M. Results of the precise field trials from the years 2004 – 2008 have shown that the significant effect on the content of ascorbic acid (AA) had the variety; the Marabel variety (247.6 mg AA/kg FM) outweighed other yellow-fleshed and coloured varieties in AA content by 13 – 74 %. In successive trials a lower AA content in the group of eight purple- and red-fleshed varieties by 17.7 % was determined in the comparison with the yellow-fleshed variety Agria in the year 2009; at the same time significant differences within the colour-fleshed group were found and the highest AA content showed the red-fleshed Highland Burgundy Red variety (in the year 2009 232.8 mg/kg FM). The high dose of N fertilisation had the negative effect on AA content. Further tendency to the higher AA contents showed in the warmest location in the Elbe valley. ascorbic acid; potatoes; purple and red flesh; location; fertilization Corresponding author: HAMOUZ, K. – LACHMAN, J. – PAZDERŮ, K. – HEJTMÁNKOVÁ, K. –
VACEK, J. – DOMKÁŘOVÁ, J. – HORÁČKOVÁ V. In the precise field trials the effect of potato varieties with yellow, red and purple flesh colour and the effect of the location conditions on antioxidant activity (AA) of tubers (determined with ABTS assay and expressed in mg ascorbic acid.100 g-1 FM) cultivated in three locations of the Czech Republic was investigated. The highest AA was determined in the dark purple-fleshed variety Violette (95.4 mg ascorbic acid.100 g-1 FM). In the purple- and red-fleshed varieties AA was in average 2.9 time fold higher in comparison with the yellow-fleshed varieties. Statistically significant differences of AA was also determined between the purple- and red-fleshed varieties, where the highest AA values were determined in the varieties with the highest anthocyanin content (it ranged from 18.8 to 64.1 mg of cyanidin.100 g-1 FM). Obtained results did not proved the effect of the location on AA content of tubers. potatoes; purple- and red-fleshed varieties; antioxidant activity; total anthocyanins Corresponding author: JŮZL, M. – ROŽNOVSKÝ, J. – ELZNER, P. –
JANEČKA, L. – KASAL, P. The aim of the article was to evaluate differences in length of potato phenological stages on two different localities - Žabčice (corn production area) and Valečov (potato production area). Results are based on observations between the years 2004 and 2008. For evaluation was used early potato variety Karin. We observed length of these phenological stages: beginning of emergence, full emergence, butonisation, beginning of flowering, full flowering, yellowing and leaves necrosis. The length of observed phenological stages was affected by locality. It was probably caused by different climatic conditions during vegetation. potatoes; phenological stages; locality; variety Corresponding author: VOKÁL, B. – DOMKÁŘOVÁ, J. – ŠIMKOVÁ, D. – BUCHER, P. The exact field trials performed between 2005 and 2008 evaluated the importance of several factors for tuber and starch yield formation, starch and dry matter content of 16 starch potato varieties in selected localities (5) in the Czech Republic. Four-year results indicate that the effect of studied factors exceeded limit of statistical significance. Both tuber and starch yield was most affected by year (F = 196,27** and 103.41**), starch and dry matter content was most affected by variety (F = 51.51** and 28.74**). For varieties, tuber yield on average ranged between 46.84 (Tomensa) and 65.65 t.ha-1 (Kuras), for localities between 49.65 (Vysoká nad Jizerou) and 60.16 t.ha-1 (Lukavec) and for years between 49.74 (2006) and 62.30 t.ha-1 (2005). This tendency was also true for starch yield that was influenced by tuber yield to a decisive extent. For localities, starch content of evaluated varieties on average ranged between 18.06 (Sonate) and 22.71 % (Roberta), for localities between 19.64 (Horažďovice) and 20.99 % (Valečov) and for years between 19.51 (2007) and 20.78 % (2008). Dry matter content on average ranged between 25.79 (Sonate) and 30.18 % (Roberta) for varieties, between 27.38 (Lukavec) and 28.84 % (Vysoká) for localities and between 27.24 (2006) and 28.50 % (2008) for years. It was proven that variety has the decisive importance for starch and dry matter content, character of year had the decisive importance for tuber and starch yield and to a certain extent also locality, which influenced tuber and starch yield more than variety. potatoes; variety; locality; year; tuber yield; starch yield; starch content; dry matter content Corresponding author: KASAL, P. –
ČÍŽEK, M. – SVOBODOVÁ, A. Between 2007 and 2009 an effect of two ways of tillage (shallow tillage, ploughing) was studied on soil physical characteristics, especially bulk density and porosity in growing of several crops (potatoes, winter wheat, spring barley, pea and poppy). In relation to the way of tillage yield of grown crops was also observed. Under trial conditions it was found that grown crops more markedly affected soil characteristics (in potatoes significantly) compared to tillage. The effect of various ways of tillage on yields differed in individual years and also for crops growing after cereal (spring wheat), after tuber crop (potatoes) and oil crop (poppy). Growing crops after potatoes higher yields were mostly obtained in minimization variant with shallow tillage compared to deeper ploughing. ploughing; shallow tillage; yield; bulk density; porosity Corresponding author: ČEPL, J. – KASAL, P. Ten Jerusalem artichoke genotypes – Běloslupké, Reka, Refla, Karina, Urodny, Vörkenroder spindel, Lola, Gigant, K 24 and C 63 were included into the varietal field trial in Valečov Research Station of PRI Havlíčkův Brod (potato production region, above sea level 460 m, annual rainfall amount 652 mm, annual mean air temperature 7.0 °C, cambizem). The aim of the study was to verify suitability of growing these varieties under set conditions and to find suitable materials as regard as tuber yield formation. The results of 2006 – 2008 indicate that the highest tuber yields were obtained, across the years, in genotypes Lola (59.4 t/ha), followed by Běloslupké (56.2 t/ha), Karina (55.7 t/ha), Urodny (54.6 t/ha) and Völkenroder spindel (54.4 t/ha). Aboveground biomass production was determined in individual varieties and the highest dry matter per 1 hectare was recorded for the genotypes Karina (11.0 t) and Lola (9.1 t). Jerusalem artichoke; genotype; tuber yield Corresponding author: Scientific Studies 2008
ČEŘOVSKÁ, N. – DĚDIČ, P. – PLCHOVÁ, H. – MORAVEC, T. – HOFFMEISTEROVÁ, H. The gene encoding the coat protein (CP) of a Potato virus Y (PVY) was cloned into expression vector pMPM-A4Ω. PVY CP was expressed in Escherichia coli and the purified recombinant protein was used for raising rabbit polyclonal antibodies. The obtained sera and antibodies were used for the detection of PVY in laboratory host Nicotiana tabacum, cv. Samsun and in various cultivars of natural host Solanum tuberosum by ELISA as well as by Western blots. The antibodies were specific for the detection of the whole strain spectrum of the Potato virus Y by indirect plate trapped antigen ELISA (IPTA ELISA) and Western blot, but not by double antigen sandwich ELISA (DAS ELISA). recombinant antibodies; PVY; modification of ELISA Corresponding author: ČÍŽEK, M. – KASAL, P. – SVOBODOVÁ, A. – HAMOUZ, K. – LACHMAN, J. The objective of several years of field experiments was to explore the changes in the total content of poly-phenols, carotenoids and ascorbic acid, as important anti-oxidants, in potato tubers at various levels of N, P, K and Mg nutrition. The content of poly-phenols, carotenoids and ascorbic acid was affected particularly by the weather in the experimental year; the fertilization variants had no significant effect on the content of poly-phenols. A negative effect on ascorbic acid content in tubers was observed in the case of an increased intensity of N fertilization (at 180 kg N.ha-1 ascorbic acid decrease was lower by 6,1 % compared to doses 100 kg N.ha-1). The content of carotenoids was affected by the weather and also by the cultivar of potatoes. On the contrary intensity of fertilization had no significant effect on content of carotenoids. potatoes; anti-oxidants; ascorbic acid; poly-phenols; carotenoids Corresponding author: DĚDIČ, P. – ČEŘOVSKÁ, N. – PLCHOVÁ, H. – MORAVEC, T. – FILIGAROVÁ, M. – PTÁČEK, J. The gene encoding the coat protein (CP) of Potato virus X was cloned into expression vector pMPM-4A Omega. PVX CP was expressed in Escherichia coli and was used for raising rabbit polyclonal antibodies. For immunization we purified CP fractions from bacterial lysate either by simple fractionation or by excision from SDS gel. The obtained sera and antibodies were tested for the detection of PVX in laboratory hosts Nicotiana tabacum, cv. Petit Havana SR 1 and N. benthamiana and in various cultivars of natural host Solanum tuberosum by ELISA as well as by Western blots. The antibodies were specific for PVX and are usable for the detection of the broad isolates spectrum of the Potato virus X by indirect PTA ELISA and Western blot. DAS ELISA with AP conjugated recombinant antibodies failed in detection of all PVX isolates. PTA ELISA; recombinant antibodies; reactivity Corresponding author: KREUZ, L. – DOMKÁŘOVÁ. J. – HORÁČKOVÁ V. The chytridiomycete Synchytrium endobioticum is a causal agent of potato wart disease. It is monitored quarantine disease subject to strict worldwide regulations. More than 40 races exist. The resistance genes Sen 1-4 and Sen 1 against S. endobioticum are localized on chromosomes IV and XI respectively. The aim of our work was detection of majorgene Sen1 situated on distal part of chromosome XI in genomic region, which is related to the tobacco genome segment harbouring the N gene for resistance to TMV (tobacco mosaic virus). Two markers Nl27 and GP125 were selected. They should have been able to detect region mentioned above. The results showed that GP125 is not applicable in MAS. Gen Sen1 provides resistance against races 1, 2 and 6. The phenotype symptoms of resistance toward potato wart disease were at most tested genotypes demonstrated. Solanum tuberosum; Synchytrium endobioticum; potato wart disease; DNA marker; potato Corresponding author: MATOUŠEK, J. – ORCTOVÁ, L. – PTÁČEK, J. – DĚDIČ, P. Weed plants characteristic for potato fields have not been considered in the past as potential hosts that could transmit and lead to spreading of potato spindle tuber viroid (PSTVd). To gain insight into this problem, we biolistically inoculated these weed plants with viroid populations either as RNA or as cDNA PSTVd variants. New potential viroid host species, collected in central Europe, were discovered. From 12 weed species characteristic for potato fields, high viroid levels, detectable by molecular hybridization, were maintained after both RNA and DNA transfers in Chamomilla recutita and Anthemis arvensis. Low viroid levels, detectable by reverse transcription-PCR (RT-PCR) only, were maintained after plant inoculations with cDNA in Veronica agrestis and Amaranthus retroflexus. In these two species PSTVd concentrations were 105 and 103 times, respectively, lower than in tomato as estimated by real-time PCR. Characteristic monomeric (+)-circular and linear viroid RNAs were present in extracts from weed species propagating viroids to high levels, indicating regular replication, processing, and circularization of viroid RNA in these weed species. In cultured chamomile (Chamomilla recutita var. Bohemia) the pathogenesis symptoms were observed in similar strength as for tomato cv. Rutgers. The strongest symptoms and growth suppression were characteristic for letal strain AS1, while mild symptoms were observed for mild viroid variant. potato fields; weed plants; potato spindle tuber viroid Corresponding author: NAVRÁTIL, O. – VACEK, J. – BUCHER, P. Transgenic potato plants, which express in tubers the cold-resistant phosphofructokinase, are for several years tested in field trials in Czech Republic. Already the third genetically modified cultivar has been introduced in trial. The results of tuber analysis from transgenic plants demonstrate repeatedly the positive effect of the exprimed transgene on both the amount of reduced sugars and the frying color of potato chips. The same results were obtained with the transgenic lines of the new cultivar, i.e. the decreased amount of reducing sugars in long-stored tubers compared to tubers from nontransgenic plants. cold-storage of tubers; phosphofructokinase; transgenic plants Corresponding author: Polzerová, H. – Greplová, M. The inactivation of cellular nuclei and semiautonomous organelles was studied in the mesophyll protoplasts of Solanum verrucosum PI 161173 and S. tuberosum (cv. Karin, cv. Komtesa, cv. Kordoba). The protoplasts of S. verrucosum were UV-irradiated to inactivate the nuclei after determining the optimal UV dose (germicidal lamp - wavelength of 254 nm, an intensity of 370 µW . cm-2 for 10 min). The cellular organelles of the S. tuberosum protoplasts were inactivated. Various concentrations of iodoacetamide (IOA; 0.125 mM; 0.25 mM; 0.3 mM; 0.4 mM; 0.5 mM; 1 mM; 2 mM; 5 mM), iodoacetic acid (IOAA; 0.125 mM; 0.2 mM; 0.25 mM) and rhodamine 6G (RH6G; 0.05 mM; 0.1 mM; 0.125 mM; 0.25 mM) were tested and optimal concentrations (0.4 mM IOA and 0.2 mM IOAA) were determined for use in asymmetric somatic hybridization. All tested concentrations of RH6G proved toxic and lower doses should be employed. The UV irradiated protoplasts of S. verrucosum and the protoplasts of S. tuberosum with inactivated metabolism were then electrofused. Regeneration of the fused protoplasts and nonfused treated protoplasts (UV or 0.2 mM IOAA or 0.4 mM IOA) were evaluated. Fused protoplasts were more viable and prospered better than treated nonfused controls. Plant regeneration in fusion combination S. verrucosum (UV treated) + S. tuberosum cv. Karin (0.4 mM IOA treated) was recorded. The usefulness of cybridization in Solanum genus is discussed. asymmetric somatic hybridization; iodoacetic acid; iodoacetamide; rhodamine 6G; UV-irradiation Corresponding author: PTÁČEK, J. – DĚDIČ, P. – VENCOVÁ, J. – HORÁČKOVÁ, V. The aim of this study was to test the PRI GMO collection on the presence of some genetic modifications. Selected potato genotypes (GMO and controls) were used as experimental material. Our work compared two DNA extraction techniques from potato leaves followed by PCR and Q-PCR identification of GMO. The genetic modifications were reliably detected by means of PCR and Q-PCR from the GMO PRI collection. genetically modified organism; polymerase chain reaction; real-time polymerase chain reaction; potato Corresponding author: PTÁČEK, J. – KREUZ, L. – POLZEROVÁ, H. – DĚDIČ, P. The RAPD procedure was used to identify twenty two potato (Solanum tuberosum) varieties, representing the results of Czech potato breeding in last four years. Genomic DNA was used as a template in RAPD amplification with two decameric primers (P72 and Hel7). The agarose gels were documented by means of the KODAK DC290 and the similarities of RAPD profiles were estimated with the Dice coefficient and then the data were processed by cluster analysis (UPGAMA). Each genotype was identified and distinguished from the others. Our results indicate that RAPD technology is a rapid technique usable for identification of potato genotypes in PRI Havlíčkův Brod. potato; Solanum tuberosum; DNA polymorphisms; RAPD; identification; Czech cultivars Corresponding author: RASOCHA, V. – KLOFÁČOVÁ, P. – HAUSVATER, E. – DOLEŽAL, P. Aphid flights into seed potato crops were monitored using of yellow water traps in 2003 – 2007. Date of flights, number and species distribution of virus disease vectors were studied along with basic meteorological data – temperature and rainfall. Potato plant growth was also observed. Occurrence of virus diseases was determined in the post-harvest tests of seed potato lots by ELISA technique. The lowest spread of virus diseases was recorded in 2004. It was also reflected in results of post-harvest tests. In the submitted seed potato generation 89.4 % of crops were certified, 3.6 % downgraded and 7.0 % rejected in this year. In total, 1939 winged aphids were trapped. Slightly worse results from post-harvest tests were found in 2005 and 2003. Considering post-harvest tests the year 2007 was the worst one, when the lowest number of seed potato crop areas was certified, i.e. 70.2 %, 6.1 % were downgraded and 23.7 % rejected. In this year the aphid flight was early, strong and very dangerous as regard as species. Already in May totally 1615 aphids were caught, out of this number 95 belonged to Myzus persicae and 18 to Aphis nasturtii. Similar results of post-harvest tests as in 2007 were recorded also for 2006, when 73.9 % of seed potato crops were certified, 3.0 % downgraded and 23.1 % rejected. In this year the aphid flight was delayed and very weak in the first two decades of June. In the third decade of June 2006 a breakage was found, when occurrence of the most important potato virus vectors Myzus persicae, Aphs nasturii and Phorodon humuli significantly increased. Delayed planting of potatoes and subsequent plant emergence in the period of increased vector occurrence caused high spread of virus diseases. Young potato plants are very sensitive to virus infection. Presence of infection sources had also an impact on virus disease spread. potatoes; vector occurrence; virus disease spread 2003 – 2007 Corresponding author: SEDLÁK, P. – VLASTNÍKOVÁ, H. Phytophthora infestans, the causer of late blight, is pathogen with large economical importance. Early detection of pathogen presence in growth can be very often complicated by weather development and another environmental conditions or by interactions with host genotype. This paper is aimed to put information about possibility to use of polymerase chain reaction (PCR) as an additional method of late blight diagnostics in optional causes when the pathogen activity is not too much obvious, and to summarise the results of optimisation accomplished in goal of P. infestans direct detection in potato tissues (in planta). In an effort to complete this goal were examined selected DNA markers amplified by different primers; there were markers O8, AE7, PINF-ITS5 and PISP-1 – ITS5 published previously in relevant sources. All of these markers are detecting highly specific polymorphisms in ribosomal RNA gene family. It was proved, that the process of direct detection of P. infestans DNA in planta could be significantly affected by many factors. For example, any of used markers was not able to detect DNA of pathogen in necrotised parts of leaves. Only 450bp DNA fragment amplified by primer set PISP-1 – ITS3 proved 100% reproducibility and reliability to detect of pathogen DNA in planta in early stages of infection especially. late blight; molecular diagnostic; DNA markers; ribosomal RNA gene polymorphism Corresponding author: SEDLÁKOVÁ, V. – HAUSVATER, E. – DOLEŽAL, P. Common scab, Rhizoctonia cancer and silver scurf are common diseases of potato. Each of them can intensively reduce quality of potato tubers. From 2004 to 2007 there were evaluated 75 potato cultivars of Czech and European assortment in field trial at the trial station of Potato Research Institute, Valečov (Czech Republic). Injury of tubers was evaluated by means of nine-point scale. There was detected statistically significant difference of year 2004 from other three years in light of injury of tubers for common scab and silver scurf. There was detected positive statistically significant correlation between occurrence of these two diseases (correlation coefficient r = 0,176). Rhizoctonia cancer was identified as the disease with the lowest level of occurrence; conversely the highest injury level was detected for silver scurf in terms of evaluated cultivars. There were evaluated cultivar Adéla with the least injury and cultivar Adora with the highest injury in the complex evaluation. potato varieties; common scab; Rhizoctonia cancer; silver scurf; statistical analysis Corresponding author: ŠIMKOVÁ, D. – PAPOUŠKOVÁ, L. The aim of our study was to evaluate the enzymatic method (kits by Megazyme). In two independent institutes (Crop Research Institute and Potato Research Institute) amylose content was determined in winter wheat grains and potato starch samples in multi-year experiments. There was also an interlaboratory test of two samples of winter wheat varieties (Šárka, Bergland) and two potato starch samples (varieties Amado, Roberta). potato starch; wheat flour; amylose; amylopectin; enzymatic method Corresponding author: VOKÁL, B. – DOMKÁŘOVÁ, J. – DOLEŽAL, P. – NOVOTNÝ, J. The aim of exact field trials performed on Valečov Research Station was to verify an effect of selected varieties (16) and year (2005 – 2008) on total starch content and yield. Four-year results indicate highly statistical significant effect of evaluated varieties and year on the level of studied indices. The effect of varieties was most expressed especially in starch content (F = 11,71**). The character of year (especially weather progress) was expressed in both evaluated indices; however, more in starch yield (F = 44,23**). The highest tuber starch content was on average recorded for the year with above normal temperatures during growing season and minimal rainfall in warm September (year 2006). Favourable weather progress in 2008 led to the highest starch yield, despite of decrease in tuber starch content. Starch yield affected tuber yield much more significantly compared to tuber starch content. Starch content of potato tubers was not unambiguously associated with duration of growing period in evaluated varieties. Two medium early and one early variety were the best evaluated varieties and on contrary relatively low tuber starch content was determined in both early and late varieties. potatoes; varieties; year; starch content; starch yield Corresponding author: HORÁČKOVÁ, V. – DĚDIČ, P. – PTÁČEK, J. The paper describes a system of virus-free breeding and potato maintenance breeding using of biotechnological methods and procedures. Concrete techniques used for development and maintenance of virus-free collections are presented and practical use of the system on breeding workplaces is documented. potatoes; in vitro cultures; eradication of virus infection; virus-free breeding Corresponding author: Scientific Studies 2007
DĚDIČ, P. – MATOUŠEK, J. – PTÁČEK, J. Occurrence of potato virus S was detected in gene bank germplasm, in Czech breeders´ materials and in imported seed-potato. By differential diagnosis on Chenopodium quinoa indicator plants the finding of some isolates with ability to infect this indicator plant systemically (isolates PVS-CS) was proved. High sequentional divergences were found at these isolates comparing with PVS-O ones, using molecular approach by RT-PCR, but unambiguous differentiation of chenopodium systemic (CS) isolates in our work with primers designed for selected parts of CP and TGB, respectively, was not successful until now. Using molecular approach the considerable diversity among European PVS-CS and originally described Andean strains were found. ELISA; indicator plants; RT-PCR; CP and TGB Corresponding author: DOMKÁŘOVÁ, J. – KREUZ, L. – ŠVECOVÁ, R. – GREPLOVÁ, M. – HORÁČKOVÁ, V. – POLZEROVÁ, H.
The study reviews knowledge of potato interspecific hybridization carried out during 2004-2006. For development of interspecific hybrids (Solanum tuberosum x wild species) wild diploid species were used possessing putative resistance to potato late blight and Colorado potato beetle (S. berthaultii PI 310925 denominated PS 8/2, S. bulbocastanum PI 243512 denominated PS 12/16, S. pinnatisectum PI 320342 denominated PS 5/6, S. verrucosum PI 161173 denominated PS 16/4) and their tetraploid regenerants derived by mitotic polyploidization (S. berthaultii PS 8/2 – OR 3/19, OR8/6, S. bulbocastanum PS 12/16 – OR7/14, OR7/19, S. pinnatisectum PS 5/6 – OR9/1, OR9/8, S. verrucosum PS 16/4 – OR8/20, OR9/19). They were hybridized with S. tuberosum varieties, S. tuberosum primary dihaploids, developed by parthenogenesis or androgenesis and S. tuberosum secondary dihaploids. Used materials originated from the bank of potato genetic resources maintained in the Potato Research Institute in Havlíčkův Brod. Hybridity of progeny after interspecific hybridization was visually assessed by morphological traits and a RAPD technique. Totally, 227 combinations were done and 2465 flowers were crossed, which provided 73 berries (2.96 %). Four hundred twenty-eight seeds were obtained, i.e. 0.17 seed per flower and 5.86 seeds per berry. The combination S. tuberosum dihaploid 99.189/4 x S. berthaultii gave the highest production of seeds per berry, 53 seeds per berry. The best results of hybridization were achieved in 2006, when totally 307 seeds formed. Hybridity of 35 seedlings was verified by morphological traits and a RAPD technique. potato; interspecific hybridization; late blight; RAPD Corresponding author:
DOMKÁŘOVÁ, J. – VOKÁL, B. The study was focused on level and developmental trends in starch content of potato varieties based on the analysis of gene pool collection of Solanum tuberosum L. varieties originating from 1952–1996. The collection consisted of three sets: 1952–1970 (630 varieties), 1971– 1989 (559 varieties) and 1990–1996 (253 varieties). Determined level was discussed with current level of starch content in grown varieties (totally 177 varieties averaged over the years 1997–2005). Starch content was determined by Ewers polarimetric method and evaluated on a 9-score scale; intermediate to high starch content was assigned to score 6 (18.1–20.0 %). For the score 7 the content was 20.1–22 %, for the score 8 it was 22.1–24 % and the highest starch content (more than 24.1 %) was assigned to score 9. Growing period duration of used varieties was also taken into account in evaluations. From statistical assessment of derived results an unambiguous trend of starch content increase is resulting with prolonging duration of growing period. Starch content over 18.1 % (evaluation score 6–9) was determined in 23.2 % of varieties from 1952–1970, only in 10.2 % from 1971–1989 and in 23.7 % varieties from 1990–1996. In last evaluation period (1997–2005) it was 13.5 % varieties. Distribution of varieties with starch content more than 22 % was relatively low and ranged between 0.2 % (1952–1970) and 1.6 % (1990–1996). In the set of varieties received after 1971 genetic resources with starch content more than 18.1 % in medium-early potato varieties were also found. potatoes; tuber starch content; gene pool; varieties; growing period Corresponding author:
Fajkus, J. – Sýkorová, E. – Neplechová, K. – DĚDIČ, P. – Novotná, M. – Ptáček, J. Molecular genotyping techniques are of still increasing importance in agriculture practice and trade. Here we summarize results of research projects in which a novel assay for genotyping of potato cultivars was established. The assay is based on PCR using combinations of primers derived from telomeric and telomere-associated sequences. A high degree of sequence polymorphism and, namely, the variability in mutual arrangement of otherwise conserved sequence-building-blocks of subtelomeres, enabled us to establish a simple and reliable PCR-based assay to distinguish potato cultivars in 2-3 PCR reactions. PCR; telomere-associated sequences; potato cultivars Corresponding author: Fišerová, H. – KLEMŠ, M. – MIKUŠOVÁ, Z. – SLÁMOVÁ, Z. – VAŠATOVÁ, V. –MACHÁČKOVÁ, I. – ČEPL, J. – KASAL, P. Production of ethylene, ethane and carbon dioxide, as well as the level of abscisic acid in tubers and sprouts isolated from tubers at the beginning of March were studied with the purpose to find a marker (or markers) of vitality of potato seed material. Samples were obtained from experimental plots in Valečov within the period of 2003–2005. When studying these experimental potato tubers, varietal differences in relationships existing between production of gases by tubers and sprouts on the one hand and contents of abscisic acid in tubers and sprouts were statistically analysed with regard to effects of air temperatures and precipitation in the course of growing season. Tubers of late varieties mostly contained more ABA and produced less ethylene, ethane and carbon dioxide while in tubers of early varieties the content of ABA was lower and the production of aforementioned gases was increased. Isolated sprouts of late varieties contained surprisingly less ABA and produced lower amounts of ethylene, ethane and carbon dioxide while in isolated sprouts of early varieties the level of ABA was higher and production of ethylene, ethane and carbon dioxide was increased in all years under study. germination of tubers; growth of isolated sprouts; physiological parameters Corresponding author: Greplová, M. – POLZEROVÁ, H. Conditions for protoplast isolation and plant regeneration on protoplast-derived calli in members of the genus Solanum were studied. Protoplast yield from plants cultivated on MS medium were compared with SH medium. Protoplast yield from plants cultivated on SH medium was unambiguously better in case when donor plants were maintained and subcultured on the medium in the stage of intensive growth. The protoplast-derived calli were tested for response to the graded contents of the plant hormones with ratio 1:5 IAA:ZT and to the contents with different ratios from 1:4 to 1:25 IAA and ZT with aim to short time needed for organogenesis. The experiments were performed in tissue-culture plates with 4 x 6 wells. The growth regulators were applied into MS medium. The application period was 90 days. The perspective combination was 0.1 mg/1 IAA, 2 mg/l ZT. The necessary time for start of shoot regeneration was in average 1 month shorter as compared to earlier experience. The perspective concentration of plant hormones was subsequently verified on group of cultivated calli in Petri dishes. The positive effect was observed especially on protoplast-derived calli after electrofusion. A gradually increased concentration of growth regulators with the ratio 1:5 auxin:cytokinin did not result in plant regeneration. protoplast-derived calli; Solanum tuberosum; wild Solanum species; plant regeneration; plant hormones Corresponding author: Greplová, M. – Polzerová, H. – Kreuz, L. The representatives of genus Solanum, which positively responded to protoplast culture and achieved the plant regeneration well, were chosen for model electrofusion of protoplasts. The aim of model fusion was to verify the suitability of optimized electric field parameters and to obtain somatic hybrids as the compact plants in short time. It is described the procedure of protoplast isolation, fusion and culture to the plant regeneration. The optimal doses for successful fusions were 95-100 V/cm AC with individual operation time (2– 15 s) followed by 190– 200 V/cm DC for 80 µs. Cut plants were estimated by the flow cytometry and DNA analysis, namely RAPD. Total number of regenerated plants was 579, RAPD revealed 25 somatic hybrids. The fruitfulness of somatic hybridization and its utilization as alternative breeding tool is discussed. electrofusion; protoplasts; RAPD; Solanum tuberosum Corresponding author: HAUSVATER, E. – MAZÁKOVÁ, J. – DOLEŽAL, P. – TÁBORSKÝ, V. – RASOCHA, V. – RYŠÁNEK, P. – SATRAPOVÁ, V. During 2003–2006 potato and tomato plants with late blight symptoms were collected from various regions and localities of the Czech Republic. A total of 352 Phytophthora infestans isolates were collected and analysed for mating types and metalaxyl and dimethomorph sensitivity. Mating types were determined using the conventional pairing assay and CAPS technique and ratio of A1 to A2 mating type was recorded 68 %:32 % for the benefit of A1 mating type. Almost all isolates were found metalaxyl and dimethomorph sensitive. Only 18 isolates from 2003 were resistant and four isolates from 2004 were intermediate to active substance metalaxyl. Simultaneously, exact field trials with the medium-early potato variety Ditta were established on experimental station PRI Havlíčkův Brod – Valečov and studied the efficacy of fungicides against potato late blight. In 2003 no late blight occurred in the trials; however, tuber yields increased in majority of fungicides. The years 2004–2006 were characterized by mild to average infection pressure of the pathogen and low tuber infection. Differences in fungicide efficacy were small and mostly statistical insignificant. The highest efficacy was found in the variant of cymoxanil/mancozeb. Minimal occurrence of metalaxyl resistant strains of the pathogen permitted good efficacy of metalaxyl M/mancozeb based fungicide. Fluazinam and chlorothalonil/prophamocarb HCl revealed standard high efficacy. No changes in fungicide efficacy were found in the trials in the context of occurrence of A2 mating type in the pathogen populations. potatoes; late blight; mating types; resistance, fungicide efficacy Corresponding author: HORÁČKOVÁ, V. – DOMKÁŘOVÁ, J. – KREUZ, L. The submitted study summarizes findings derived from testing of resistance to potato late blight in an in vitro culture by artificial infection via pathogen spore suspension. Evaluation was done in a selected set of 166 potato genetic resources originating from the in vitro gene bank stored in the Potato Research Institute in Havlíčkův Brod. The laboratory method has the character of negative selection that enables to catch and eliminate susceptible forms based on quantitative differences in plant infection. The tested set was divided into three groups, the first one involved 18 genotypes (14.3 %) with very high to high relative resistance, the second one involving 44 genotypes (26.6 %) had parameters of intermediate resistance and the third one consisted of 98 genotypes (59.1 %) with parameters of low to very low resistance to potato late blight. In vitro selection is the primary test, which enables to reduce the volume of tested material. Logically, pre-selection must be followed by further evaluation verifying the determined level of resistance in the field conditions. This technique brings an advantage of work-saving performance of tests on material maintained in the virus-free state, in standardized conditions, regardless season. potatoes; genetic resources; in vitro selection; Phytophthora infestans Mont de Bary Corresponding author: JŮZL, M. – HLUŠEK, J. – ELZNER, P. – LOŠÁK, T. In field trials during three years the influence of soil applications (12, 24, 48 a 72 kg Se.ha-1) and foliar applications (100, 200 a 400 g Se.ha-1) of selenium was observed on hectare yield and number of tubers per plant. By the AAS method concentration of selenium was also observed in raw tubers, boiled tubers and in potato chips. Hectare yield and number of tubers significantly decreased with increasing dose of selenium. In the variant with the highest applied dose of selenium the hectare yield was decreased approximately to 50 %. Less expressive decrease of hectare yield was after foliar application of Se. Simultaneously with the dose of selenium concentration of Se in tubers also increased. Sufficient increase was marked in all variants. During boiling and frying of potatoes concentration of selenium decreased about 20–30 %. potatoes; yield; number of tubers; selenium; quality Corresponding author: KASAL, P. – BRANT, V. – ČEPL, J. – HOLEC, J. Biomass production and coverage of catch crops, volunteer forecrop (wheat), and weeds were measured in potato growing area during the years 2004–2006. Experimental plots were sowed by Brassica napus, Phacelia tanacetifolia, Raphanus sativus, Sinapis alba, Trifolium incarnatum and mixture of Trifolium incarnatum + Lolium perenne. Crops were sowed after shallow soil tillage which was done by sweep cultivator. The highest biomass production was recorded by S. alba, P. tanacetifolia and R. sativus. The lowest mean values of aboveground biomass weight were found by T. incarnatum. Stands of this species also showed the highest rate of weediness and volunteer wheat occurrence. The experiments confirmed that biomass production of catch crops in potato growing area is significantly influenced by early beginning of low-temperature period, which shortens the duration of vegetation period of the catch crop. High sensitivity to temperature decrease showed especially stands of S. alba and R. sativus. catch crops; biomass production; dominance; volunteer; weed Corresponding author:
KASAL, P. – RŮŽEK, P. – KUSÁ, H.
The effect of different technology of potato cultivation and nitrogen fertilizer application (local vs. broadcast) at planting on yield and quality of potato tubers was observed in 2004-2006 in the field trials on Valečov Research Station of Potato Research Institute in Havlíčkův Brod. The content of nitrate and ammonium nitrogen in soil was analysed during vegetation and after harvest. The highest tuber yield was repeatedly obtained from variants with band application of liquid mineral fertilizer UAN 390. From the view of quality parameters no significant difference among tested variants was mostly found. The positive effect of local (band) application of mineral nitrogen fertilizers at potato planting on decrease of nitrate content in soil and consequently risk of water pollution by nitrates was observed. potatoes; mineral fertilizers application; nitrate in soil; tuber yield and quality Corresponding author: MATOUŠEK, J.– KOZLOVÁ, P.– RůŽKOVÁ, E.– SCHUBERT, J.– DĚDIČ, P. New extraction procedure was developed to detect potato viruses S and Y by a dot-blot hybridization. While a classical AMESS extraction is ineffective for these potato viruses, an improved extraction buffer that contains 5% SDS enabled a sensitive detection without need to purify RNA with expensive procedures. An alternative biolistic inoculation method was developed for potato virus S (PVS). Biolistic inoculation with CsCl-purified PVS led to strong pathogenic effect on tomato cv. Nevske and to high levels of PVS accumulation. As detected by the dot-blot hybridization with a "bypass" PVS probe, an infection was achieved even after biolistic inoculation with total RNA isolated from infected plants i.e. without any need to purify virus RNA. This suggests much simpler preparation of biolistic inocula for special handling of plant viruses and their mixtures. potato virus S; extraction; dot-blot; RNA Corresponding author: PÁNKOVÁ, I. – KREJZAR, V. The mixture of eight rifampicin-resistant mutants was used as tool for greenhouse study of survival of Clavibacter michiganensis subsp. sepedonicus (Cms) in weed species and arable crops. The 2–4 weeks old arable crops – rape (Brassica napus L.) and barley (Hordeum vulgare L.) and weed species – nightshade (Solanum nigrum L.), fat hen (Chenopodium album L.) and sea lyme grass (Elytrigia repens L.) were dipped for 24 h in a suspension of ca 109 cells/ml of Cms. Survival of the Cms bacteria in different part of plants was studied. The occurrence of Cms was tested two months after plating with the Sherlock and Biolog microbial identification system. After two months visually the infected plants could not be distinguished from non-infected plant. Despite the use of antibiotic mutants and plating three different samples from three different phases of reisolation it was impossible to recover Cms by direct plating of plant tissue homogenates. Clavibacter michiganensis subsp. sepedonicus; rifampicin resistant mutant; Sherlock; Biolog; arable crops; weed species Corresponding author: RASOCHA, V. – HAUSVATER, E. – DOLEŽAL, P. – KLOFÁČOVÁ, P. – LAUTERER, P. During 2004–2006 occurrence of Auchenorrhyncha in potato crops was observed in the locality Havlíčkův Brod – Občiny using a yellow trap, which was also used for study of aphid flights. Further, sweeping of potato crops and inspection of 100 plants were also performed to observe occurrence of Auchenorrhyncha. From applied ways of Auchenorrhyncha study yellow traps placed directly above potato plants proved to be the best method. Auchenorrhyncha individuals were sampled three times a week, in morning hours on Monday, Wednesday and Friday. The leaf method “100 plants” was problematic due to frequent mobility of Auchenorrhyncha. Good results were also obtained in sweeping of crops. Caught Auchenorrhyncha individuals were placed into 60% alcohol and later determined. In 2004, when only experimental catches were carried out, the highest occurrence of Auchenorrhyncha was found in the end of June and beginning July. Considering species distribution Empoasca genus significantly predominated, species Empoasca pteridis and Empoasca vitis. In 2005 Empoasca genus had also the dominant position with the most frequent distribution of Empoasca vitis. The highest occurrence of Auchenorrhyncha was recorded in the end of May and in the first two decades of June. Slight potato leaf damages, so-called “yellow spotting” were found caused by Auchenorrhyncha feeding. In 2006 the most frequent occurrence of Empoasca vitis was recorded, 745 specimens were caught. Its first occurrences were already detected in May, the highest occurrence was determined in the period of June 9–21. From other species, Empoasca pteridis, Empoasca affinis and Psammotettix alienus were found. Potato leaf damages caused by Auchenorrhyncha were rarely determined. In sweeping of potato crops in the locality Žabčice (in south direction from Brno) occurrence of Hyalesthes absoletus considered to be the important vector of quarantine disease potato stolbur phytoplasma was not detected. potatoes; Auchenorrhyncha occurrence; species distribution Corresponding author: VOKÁL, B. – DOMKÁŘOVÁ, J. – ŠIMKOVÁ, D. The aim of exact field trials was to verify the ability of potato varieties (22) to provide relatively stable tuber starch content with regard to length of growing period and amylose content in potato starch in selected localities (5) in the Czech Republic. Two-year results show that the effect of all studied factors on tuber starch content exceeded significance limit. Localities (F = 42.75**) and varieties (F = 28.02**) were the most expressed factors. Year was relatively less expressed (F = 8.29**). For localities, starch content varied on average between 19.18 % (Vysoké nad Jizerou) and 21.40 % (Valečov) and for years between 20.15 % (2006) and 20.48 % (2005). For varieties, range of starch content was between 18.21 % (medium-late Saturna for chip and starch production) and 22.70 % (medium-late Amylex for starch production). Amylose content was significantly affected by year (F = 16.50**), variety (F = 10.14**) and also locality (9.97**). Averaged over localities amylose content ranged between 20.68 % (Horažďovice) and 22.07 % (Vysoké nad Jizerou), i.e. the highest content was recorded in the locality that revealed on average the lowest starch content. However, this finding was not confirmed averaged over years (21.01 % in 2005 and 21.62 % in 2006) and also in individual varieties. In case of varieties amylose content had relatively wide range, between 18.61 % (very late Amado) and 22.84 % (early Orbit) with a certain tendency of higher content in varieties with shorter growing period. The results of the study show that unambiguous positive relation of growing period duration and tuber starch content was not confirmed. Simultaneously, critical effect of relatively high tuber yield on starch yield was apparent. A positive interaction between starch content and tuber yield was only recorded for the variety Westamyl and this was reflected in starch yield. Therefore, starch yield was economically interesting for growers and also processors. potatoes; variety; locality; year; starch content; starch yield; amylose content Corresponding author: DĚDIČ, P. – KMONÍČKOVÁ, J. – PEČENKOVÁ, T. – HURANOVÁ, M. – ČEŘOVSKÁ, N. The truncated gene encoding the triple gene block protein 1 (TGBp1) of Potato mop-top virus (PMTV) was cloned in a His-tag expression vector pQE32. When the gene was enshortened on its 3’ end by two different restriction digestions, efficient and high yield bacterial expression was achieved, which was confirmed by SDS-PAGE and Western blot of high range bacterial culture lysate exploiting the presence of 6xHis tag on the N-terminus of these constructs. One of these two constructs was used for raising rabbit polyclonal antibodies. The obtained sera and antibodies were tested for the detection of PMTV in laboratory host Nicotiana benthamiana and natural host Solanum tuberosum by ELISA as well as on Western blots. The obtained antisera showed to be more suitable for Western blot analysis of infected plants than for ELISA. These antibodies were used to reveal the interaction between the structural and non-structural PMTV proteins with overlay method. Potato mop-top virus; recombinant protein; triple gene block; polyclonal antibodies Corresponding author PTÁČEK, J. – DĚDIČ, P. The technique of polymerase chain reaction using fluorescent labelled probes (QRT-PCR) was evaluated. For detection and quantification of PSTVd and of viruses the extraction and NA isolation procedures were optimised as well as the procedures of QRT-PCR with unspecific (SybrGreen I) and specific (TagMan) probes, respectively. Quantitative RT – PCR; viruses and viroid of potato; diagnosis Corresponding author: Scientific Studies 2003
ČEPL, J. - KASAL, P. Field trials conducted during 2000-2002 studied the effect of selected active ingredients of herbicides on weed control efficiency and yield and potato quality parameters. The trials were established on medium-textured brown soil of Valečov Research Station. Five weed species were present on trial plots. Total weed fresh weight was measured in g.m-2 and from this amount weight of following species was determined: winter Brassica napus, Galium aparine, Chenopodium album, Polygonum convolvulus and Viola arvensis. Following active ingredients were tested using application with clomazone: metribuzin, linuron and terbuthylazine with terbutryn. Winter Brassica napus was dominant weed species. This weed represented 31 % in 2000, 51 % in 2001 and 79 % in 2002 of fresh weight of all weeds pre-harvest removed from untreated control. The total weed weight of untreated control was 788,8 g.m-2 in 2000, 1135,4 g.m-2 in 2001 and 1631,1 g.m-2 in 2002. Weed control efficiency of herbicides tested was very high in 2000 and 2001 (98,8 to 99,6 %), in 2002 it was lower in relation to high weed infestation. It was 84,5 % (87,9 % efficiency against winter Brassica napus) for metribuzin, 95,8 % for linuron (94,9 %) and 90,8 % (88,4 %) for terbuthylazine with terbutryn. Tuber yield was significantly lower on untreated variants, no significant differences were found among individual active ingredients. Yield reduction (between the herbicide-treated variant with the highest yield and the control untreated variant) was 44 % in 2000, 41 % in 2001 and 48 % in 2002. Post-harvest measured tuber dry matter content was not affected by herbicide treatments. potatoes; weed infestation control; weeds; herbicides; tuber yield Contact: DĚDIČ, P. - PTÁČEK, J. - MATOUŠEK, J. Altogether 582 PVY isolates from 44 potato cultivars were collected and evaluated in the second half of nineties. Most of the isolates belonged to the PVY-N serotype (71,5 %) and some cultivars were infested with this serotype only. All the PVY isolates serologically classified as PVY-N serotype also induced vein necrosis in tobacco and it is possible to order them to PVY-N pathotype. Contrary, some potato cultivars e.g. Agria, Korela, Rosara, Rosella and Zlata were infested with PVY isolates which did not react positively with PVY-N- specific antibodies. In spite of being the PVY-O serotype, seven isolates induced vein necrosis on tobacco, thus having properties of PVY-N Wilga sub-group. No isolate of PVY-O serotype was able to induce necrotic symptoms on tubers and contrary some isolates originally classified as PVY-N may after artificial inoculation of sensitive potato cultivars evoke PTNRD symptoms in greenhouse conditions. Utilizing specific primer combinations devised by G l a i s et al. (1996), W e i d e m a n n and M a i s s (1996) and W e i l g u n y and S i n g h (1998), it was possible to detect, in the collection of 24 selected isolates, either PVY without further differentiation, or using appropriate primer combinations to discriminate between isolates of common (PVY-O) and/or necrotic (PVY-N) strain group. RT-PCR products specific for PVY-NTN gave thirteen PVY isolates using primers and/or procedures recommended by the all above-mentioned authors. All the European isolates, which evoked PTNRD symptoms on tubers of sensitive potato cultivars also displayed similar RT-PCR product. Contrary, two Canadian isolates of this type were not in agreement with the results of biological as well as molecular evaluation. On the other hand the similar RT-PCR product, as displayed European PVY-NTN isolates, were found at some isolates of PVY-N Wilga type. Our results support the opinion about great variability of PVY on their molecular level, having serious impact on the possibility of strain or sub-strain differentiation. virus strain; sub-strain; pathotypes; serotypes; PVY-NTN; PVY-N-Wilga Contact: DOMKÁŘOVÁ, J. - HORÁČKOVÁ, V. - HABĚTÍNEK, J. Potato cooking quality was measured as an index of production quality in the framework of the field germplasm collection of potato varieties. Three variety sets included into potato germplasm collection in 1952-1996 (set I - 1952-1970 - 607 varieties; set II - 1971-1989 - 563 varieties; set III - 1990-1996 - 253 varieties) were analysed. Potato cooking quality was expressed in points (maximum 100 points) as a sum of taste points (maximum 40 points) and other sensory characters. Statistical processing of the results showed that a certain shift could be found toward varieties with better quality among sets evaluated, which is the most significant in variety groups of shorter vegetation period. Tendency to more tallowy cooking classes was recorded. Introduction of cooking quality assessment according to cooking classes seems to be a reasonable change in cooking quality measurement of potato varieties. Genetic resources are reported achieving the highest values during the assessment. potato; cooking quality; Solanum tuberosum L.; variety, germplasm Contact: Fajkus, J. - Ptáček, J. - Neplechová, K. - Novotná, M. Chromosome ends (telomeres) in potato (Solanum tuberosum) are formed by tandem repeats of oligonucleotide sequence [TTTAGGG]n. It has been known that a total length of blocks of telomeric DNA varies among plant species and their varieties, and also among individual chromosome arms of the same nucleus. To detect such differences in selected potato varieties, which could be of a possible use in their identification, we performed analysis of terminal restriction fragments using pulsed-field gel electrophoresis (PFGE). In most varieties, telomeres ranged between 20 and 60 kb, while in Monalisa variety the upper limit was shifted up to 80 kb. Most of restriction enzymes (PvuII, HaeIII, TaqI) produced a smeared hybridisation pattern. However, BglII showed a doublet of hybridisation bands, probably reflecting differences in composition of telomere-associated sequences (TAS) at individual chromosome ends. To further analyse the TAS, a previously described subtelomeric sequence pST3 has been isolated from genomic DNA. It was found that individual varieties show differences in a copy number and genomic distribution of this sequence. These differences have been detected using pST3-specific primers heading out of the pST3 sequence, which thus provide amplification of spacer sequences between individual copies of pST3. Our results show that differences in the presence and lengths of thus amplified sequences can be successfully used for characterisation of individual potato varieties. plant chromosomes; telomere length; potato varieties; terminal restriction fragments; subtelomeres Contact: GREPLOVÁ, M. - FRČEK, J. - REJLKOVÁ, M. - KOPECKÝ, D. - VAGERA, J. -DOLEŽEL, J. Potato (Solanum tuberosum L.) is tetraploid (2n=4x=48) with tetrasomic inheritance, which complicates hybridisation breeding. A series of wild species of Solanum genus with desired genetic variability and resistances to pests, diseases and abiotic stresses are diploids (2n=2x=24). Polyploidisation of wild species or haploidisation of cultivated Solanum tuberosum could facilitate the hybridisation. Plants of selected wild potato species (S. pinnatisectum, S. bulbocastanum, S. berthaultii) were multiplied under in vitro conditions and nodal cuttings were treated with various colchicine (0,5; 2,0; 3,5 and 5 mM) and oryzalin (15; 20; 25 and 30 mM) concentrations applied for 8, 24 and 48 hours. Ploidy of regenerated plants was determined using flow cytometry of nuclear DNA content. Measurements indicated presence of diploid plants with unaltered ploidy (2n=2x=24) and tetraploids (2n=4x=48) and mixoploids (2x+4x or 4x+8x). Optimal concentrations for tetraploidisation in our experiment was 3,5 mM or 5 mM of colchicine solutions and 25 mM or 30 mM of oryzalin solutions. wild potatoes; polyploidisation; in vitro; Solanum; flow-cytometry; colchicine; oryzalin Contact: HAUSVATER, E. - DOLEŽAL, P. - RASOCHA, V. In the exact field trials during 2000-2002 occurrence of potato foliage and tuber late blight was determined and efficacy of fungicides was tested in early potato variety Dali. Fungicides were applied in 7-14 day interval, 5-6 times in the growing season. The first treatment was done using the negative forecasting system. In all the experimental years weather conditions were favourable to crop infection and disease distribution, severe to extreme tuber infection was recorded. The most favourable conditions for tuber infection were found in 2002, when up to 92 % of tuber were infected by late blight. Fungicide treatment increased tuber yield about 0-115 % in individual years, on average of 12-104 %. Low tuber infection and the highest yield in all experimental years were recorded following fluazinam application. Good results were also achieved in the variants treated with fungicides propamocarb HCl and chlorothalonil and dimethomorph/mancozeb. High tuber infection found following application of systemic fungicides with active ingredients metalaxyl and benalaxyl was likely caused by rapid distribution of resistant pathogen strains. Preparations containing cymoxanil/maneb, mancozeb and Cu oxychloride did not decrease tuber blight infection and severe reduction in tuber yield was due to tuber decay in soil prior to harvest. Results obtained in trials performed under conditions of strong infection pressure of late blight in susceptible variety could be used for selection of suitable fungicides for spray programs in late blight control. potatoes; late blight; fungicides; tuber infection; yields Contact: HLUŠEK, J.- ZRŮST, J.- JŮZL, M. Field trials were conducted in 1999-2001 with two potato varieties (Rosara - very early variety; Korela - semi-early variety) on two localities (Žabčice, Valečov) to study the correlation between the content of cadmium in potato tubers and tops and increasing doses of beryllium in the soil. The effect of the variety, locality and weather conditions of the year on this parameter was also evaluated. The results of chemical analyses proved that increasing doses of beryllium had a synergetic effect on the uptake and content of cadmium, which increased in both the tubers and tops in direct proportion to the Be dose in the soil. If the Be content in the soil was within the limit (regulation No. 13/1997 Sb.) the growth in the level of Cd in the tubers was statistically insignificant. In terms of the Cd content in the tubers, no differences between the varieties were observed; considerably more Cd accumulated in the tops where the difference between the varieties was significant (Rosara 1,187 mg Cd.kg-1 of dry matter; Korela 0,936 mg Cd.kg-1 of dry matter). The weather condition of the year was a relevant factor, which influenced the level of cadmium in the potato tubers and tops. The highest level in both organs was discovered in 2000 (tubers and tops 0,162 mg.kg-1 and 1,221 mg Cd.kg-1 of dry matter, respectively). The locality was seen as an insignificant factor for Cd accumulation in the tubers. The concentration of Cd in the tops was significantly higher in Valečov (1,351 mg Cd.kg-1 of dry matter). potatoes; beryllium; cadmium; variety; year; locality Contact: HORÁČKOVÁ, V. - DOMKÁŘOVÁ, J. The mission of potato genetic resource collection at the PRI Havlíčkův Brod is gathering, documentation, maintenance and guarantee for potato genetic resources in the Czech Republic. The part of this task includes systematic study particularly new introduced materials, material description and evaluation with recommendation of suitable donors of agronomic important traits and characteristics, national potato database compilation with passport and descriptive data unification according to EVIGEZ system and providing of genetic resources to inland and foreign users. Developed potato Solanum genus collection contains 1 961 genetic resources maintained in an in vitro culture. Gene bank collection is divided into six subsets (Solanum tuberosum varieties, Solanum tuberosum tetraploid hybrids, cultivated Solanum species, wild Solanum species, interspecific Solanum hybrids) according to character of maintained material. The subset “Solanum tuberosum varieties” contains 1 076 accessions i.e. 54,8 % of total number of genotypes maintained. 84,7 % of original varieties coming from inland breeding was successfully gathered. The whole collection of 94 varieties of inland breeding was subjected to large recovery from virus infection and it is fully virus-free at present. “Tetraploid hybrids” form a set of 256 genotypes of foreign origin and genotypes derived in genetic and breeding research at the PRI and also materials from clonal selection. This set contains genetic resources resistant to potato late blight based on vertical and horizontal resistances, materials with higher levels of resistances to virus diseases (immunity, hypersensitivity) and resistance to wart diseases, and also good consumption qualities. The subset “Dihaploids” presents a unique set of 242 induced primary and secondary dihaploids, interspecific hybrids and regenerants of pollen embryos. The subset “Cultivated Solanum species” includes a set of tuber-bearing, primitive cultivated potato species with various ploidy levels. Cultivated species maintained in the gene bank were derived from foreign gene banks, especially from the International Potato Center in Lima, Peru (CIP), Scientific-research Institute of Plant Production N. I. Vavilov, St. Petersburg (VIR), Plant Production and Breeding Institute Braunschweig-Volkenrode (FAL), Potato Introduction Station Sturgeon Bay, Wisconsin, USA (USPC) and USDA-ARS Experimental Station Aberdeen Idaho University, USA (DASEA). The subset “Wild Solanum species” consists of a set of 22 tuber-bearing species and 1 nontuber-bearing species. Two accessions of each species are conserved; they were derived from the world collections of potato genetic resources similar to “Cultivated species”. High enhanced biodiversity of Solanum tuberosum ssp. tuberosum varieties, S. tuberosum tetraploid hybrids and dihaploids with addition of preserved accessions of cultivated and wild species presents a wide selection possibility of donors of important agronomic and breeding characteristics for breeders and researchers. potato; Solanum L.; resistance; germplasm; in vitro Contact: PTÁČEK, J. - DĚDIČ, P. Two methods of susceptibility evaluation i.e. standard field exposure trials in natural conditions, and artificial mechanical inoculation of greenhouse plants were compared. Altogether 54 cvs. were tested in the field challenging conditions and repeated results proved different level of susceptibility/resistance of cvs. to PVS. In total 14 genotypes showed mostly higher degree of susceptibility to infection, on the contrary 20 cvs. were more resistant. Susceptibility of 54 cvs. in total were tested as well using mechanical inoculation in greenhouse and the rate of infection was checked by ELISA in progeny tubers in post-harvest tests. High level of susceptibility was found at 15 genotypes, and higher resistance to infection displayed 11 genotypes. The concurrence between field and greenhouse trials was not complete, higher agreement in the resistance rating was found in the group of less susceptible cultivars. Survey of PVS infestation in 7 potato cvs. with different susceptibility rating was conducted since 1997 to 2000 on fields of four breeding stations, using all the suitable preventive measures for virus control, as well as the flush-through seed production system, based on annual input of virus-free microplants for rapid multiplication. Two successive years of field multiplication in four different years showed increase of PVS content depending on severity of infection pressure and resistance rating of individual cultivars. Starting with virus-free materials, virus incidence after one year in the open field was usually very low, rarely exceeded 5 % (virus sources largely outside the seed lot). The second year of multiplication clearly demonstrated significant contribution of resistance to infection on virus incidence in multiplied cultivars. The presence of latent infection sources mostly inside the crop accelerated the virus spread and the level of infestation. The results clearly confirmed, among others, the necessity of maintenance of virus-free seed materials in the technical and space isolators. The application of oil emulsion is also the alternative way leading to decrease of PVS spreading in the field. ELISA; diagnosis; potato virus S Contact: Rasocha, V. - Doležal, P. - Hausvater, E. Using Lamberse yellow traps flights of aphid vectors of potato virus diseases into potato seed-propagation crops were monitored during the years 1999-2002. Flight timing, aphid number and species distribution were investigated. The effect of aphid vectors on potato virus spread was evaluated in post-harvest tests of seed-propagation lots by ELISA test. The earliest, strongest aphid flight and the most unfavorable flight as regard as aphid species was recorded in the year 2002. Till June 25, totally 5 454 aphids were trapped, 18 ones of this number were Myzus persicae and 27 ones were Aphis nasturtii. It was also reflected in the results of post-harvest tests. Due to high number of potato virus diseases 20,6 % potato seed-propagation crops were rejected and 3,1 % of the crops were downgraded. This means that only 76,3 % of potato crops corresponded to the applied grade of propagation. This result, the worst one of the years studied, could be compared to the infection year 1994 regarding aphid flight and also results of post-harvest tests. Only 58,8 % of potato seed crops were certified in the applied grade, 13,7 % of seed-propagation crops were downgraded and 27,5 % of crops were rejected. The best results were achieved in the year 2001, when aphid flight was delayed, mild and inexpressive as regard as aphid species. Till June 25, totally 1 222 aphids were trapped, only 2 were Myzus persicae and none was Aphis nasturtii. The results of post-harvest tests correspond to this fact; in the tests 95,1 % of seed-propagation crops were certified in the applied grade, 0,7 % were downgraded and 4,2 % of seed crops were rejected. In other years studied (1999 and 2000) favourable results were achieved for virus disease distribution as evidenced by vector flights. Timing, intensity and vector species distribution is important for potato virus disease spreading. Presence or absence of infection sources, plant age and state in the period of dangerous vector flight and realized control is very important. potatoes; vector occurrence; virus disease spread Contact: VEJL, P. - SKUPINOVÁ, S. - DOMKÁŘOVÁ, J. - HORÁČKOVÁ, V. - BROŽ, J. - KREUZ, L. Potato genetic resources were characterised as regard as distribution of individual genes determining resistance to pathotypes Globodera rostochiensis and Globodera pallida using standard classification and using DNA markers based on nucleic acid polymorphism. Forty-five potato varieties Solanum tuberosum ssp. tuberosum were selected for experiments. Biological tests of resistance to potato nematode Globodera rostochiensis, common pathotypes Ro 2, 3, 4, 5 and Globodera pallida, common pathotypes Pa2 Calle, Pa3 Delmsen were performed. Pot test (H-test) was used for testing. Declared resistance was confirmed in majority of varieties, except for declared resistance to pathotype Ro2-3 in TURBO variety and resistance to pathotype Ro5 in ARKONA and ESTA varieties. DNA was isolated from shoots of in vitro potato plants and leaf discs. STS-PCR (Single Sequence Sites Polymerase Chain Reaction) markers and CAPS (Cleaved Amplified Polymorphic Sequences) markers were optimized. Uniform separation system was elaborated using horizontal agarose electrophoresis. Maximum markering capacity based on statistical survey was indicated in STS-PCR marker dominant allele H1, which monogennic determines resistance to G. rostochiensis pathotype Ro1. Markers of individual loci of gene family Gro1 expressed relatively small associations with genotype resistance. Markering capacity was also confirmed in all CAPS markers for resistance to G. pallida pathotypes Pa2 and Pa3. Recent found ISSR and RAPD markers only associated with resistance to both G. pallida pathotypes. Published results of new RAPD and ISSR markers only present testing of wide range of genotypes. For detection of potential marker power it would be necessary to use repeated hybridisation experiments connected with biological progeny testing using exactly defined G. pallida pathotypes Pa2 and Pa3. potato; potato cyst nematode; Solanum tuberosum L.; Globodera rostochiensis; Globodera pallida; germplasm; resistance; DNA markers Contact: ZRŮST, J. - HORÁČKOVÁ, V. - PŘICHYSTALOVÁ, V. - REJLKOVÁ, M. In a field trial (1996-1998) there were grown all home registered potato varieties listed in the National Book of Varieties of the Czech Republic in 1996 (31 Czech, including 3 Slovakian ones). α-chaconine and α-solanine content in tubers of those varieties was measured using HPLC. Results give a survey of content of total glycoalkaloids and their two major glycoalkaloids in potato tubers in groups of varieties differing in duration of vegetation period. SGAs were determined in raw unpeeled tubers, in cooked unpeeled tubers and cooked peeled tubers, French fries and chips and percentual decrease in SGAs content was calculated against raw unpeeled tubers. After handling or food processing amount of SGAs in final products of all potato varieties was not found higher that admissible limit (200 mg.kg-1) set down by Decree of the Czech Ministry of Health No. 298/1997 of the Law Gazette. The content of SGAs in potato products is influenced, in thee first place, by the initial values of SGAs in the raw material, i.e. in raw unpeeled tubers. How much the total SGAs content decreases during production depends on the technological process. Endogenous toxic substances in foodstuffs should be systemically monitored in foodstuffs of the Czech Republic, in the same way as in other advanced countries, due to the potential health hazard for the human population. Recently, total state in the field of study on food security has been improved as evaluation of risks of dietary exposition to harmful substances in the Czech Republic. Czech potato varieties; SGAs; α-solanine; α-chaconine; HPLC; raw unpeeled tubers; cooked, unpeeled tubers; cooked peeled tubers; French fries; chips Contact: Scientific Studies 1999
ČEPL, J. - KASAL, P.: Influence of potato growing technologies on tuber yield and physical properties of soil was observed in the exact field trials established at the Research Station Valečov, Potato Research Institute Havlíčkův Brod during 1996-98. There were examined conventional technology of soil preparation in spring prior to planting with reduced mechanical cultivation and herbicide application, further technology with missing out cultural practices after planting and herbicide application and technology of growing in de-stoned beds, which consisted in furrowing and separation of stones and clods prior to planting and post-planting herbicide application. The trials were established in brown medium-textured soil of typical potato growing region of the Bohemian-Moravian Highland. Significantly higher tuber yield was recorded for the variant with de-stoning, compared to other variants with conventional soil preparation and planting. Lowering the stone and clod contents is presupposition for reduction in mechanical damage of tubers and achieving higher quality of tubers harvested. In comparison with conventional technology of growing, higher yield was achieved in technology with missing out the cultural practices. This fact shows potential negative influence of mechanical cultivation in the sense of damage on developing root system. The highest number of clods bigger than 2 cm was recorded for conventional technology of growing. Compared with other variants, the difference was intensified with the increasing size of clods. On the contrary, the variant with de-stoning had minimum content of clods bigger than 2 cm. From the results of physical quantity measurement, completely unambiguous conclusion was not drawn, but tendency dependence indicated differences between variant with de-stoning and other 2 examined variants. Samples removed during vegetation period had higher weight by volume in technology of de-stoning, what demonstrated loose soil with low compaction and at the same time higher volume of pores was found. Characteristics of soil moisture regime (soil moisture by weight and relative soil moisture) referred to the possibility of higher soil drying in the variant with de-stoning compared to other variants. potatoes, potato growing technology, de-stoning, physical properties of soil Contact: DĚDIČ, P. – PTÁČEK, J. – FILIGAROVÁ, M. – ČEŘOVSKÁ, N.: The rabbits were immunized by purified isolate of PVS (originating from potato cv. Vltava) maintained in tomato plants. The diagnostic sets for ELISA were prepared from the purified rabbit´s antibodies. Paralelly were isolated also monoclonal antibodies (MAb) from ascitic fluids of mice immunized with two conserved hybridomas. The activity of polyclonal (PAb) and monoclonal (MAb) antibodies was compared in different modifications of ELISA. The MAbs demonstrated in TAS, and mainly in DAS ELISA, in comparison with PAbs, much less effectivity as to the detectability of PVS isolates tested, as well as the test sensitivity. The devised kit based on the PAbs for DAS ELISA or DOT-BLOT on membranes is convenient for large-scale utilization. polyclonal antibodies; monoclonal antibodies; ELISA modifications Contact: FRČEK,J.: Polyplodization experiments were carried out affecting vegetative parts (stems, tuber eyes and sprouts) of Solanum tuberosum dihaploids using colchicine solution; mitotic tetraploids, hexaploids and octoploids were developed. In general, concentrations of colchicine solutions from 0,1 to 0,4 % were used, in one experiment with sprouts colchicine solution was even added with 2% DMSO. Three application methods were used: stem injection, dropping of isolated vegetable eyes on pieces of tubers and dipping of sprouts or their parts into colchicine solutions. Survival percentage of affected plants, inhibition of their growth in Co generation compared to untreated control, changes in growth habit and morphological changes were observed. Ploidy level in C1, C2 and C3 generations was determined using both indirect and cytological methods. The highest yield of doubled material in C1 generation was 30 % at 4x ploidy level and 2,7 % at 6x ploidy level using the first method, 46,7 % at 4x ploidy level, 12,5 % at 6x ploidy level and 6,7 % at 8x ploidy level using the second method, and 19 % at 4x ploidy level and 6,7 % at 6x ploidy level using the third method. Further observation on ploidy levels in C2 and C3 generations in all three histological layers L1, L2 and L3 revealed that these doubled materials are mostly instable at ploidy level, they have low viability or they do not iniciate tubers. chromosome doubling; in vivo; Solanum tuberosum; dihaploids; colchicines; mitotic polyploidization; DMSO; retetraploidization Contact: Hausvater, E. - Rasocha, V.: In the exact field trials during 1994-1998 efficacy of fungicides, fungicidal spraying programmes and cost saving and ecological treatments against potato late blight was evaluated. Occurrence of metalaxyl resistant strains was observed in isolates of P. infestans. In 1996-1998 A1 and A2 mating types was determined in individual isolates. The highest average yields were achieved with fungicides involving systemic phenylamides, contact fluazinam and systemic propamocarb HCL. The lowest yield effect was reported for copper oxychloride. Late blight infection of tubers was lowest following the application of fluazinam, fentine and dimethomorph with mancozeb. Higher average efficacy was achieved with fungicidal spraying programmes compared to the same number of treatments with a single preparation during whole growing period. The highest yield were obtained with fungicidal programme consisted of preparations with systemic component in the first half of growing period and fluazinam for final treatment. Cost saving treatment using 3 applications of preparations containing phenylamides or fluazinam were equal to spraying programmes of contact fungicides applicated in 6 sprays. Ecological treatments using 2 applications of copper oxychloride were little effective. Average number of metalaxyl-resistant strains of P.infestans was 65 % of isolates tested. Occurrence of resistant strains was lowest in June and July and was gradually increasing toward the end of the growing period. All isolates belonged to the A1 mating type. potatoes; late blight; efficacy of fungicidal protection; metalaxyl resistance; mating types Contact: HORÁČKOVÁ,V. - DOMKÁŘOVÁ,J. - GREPLOVÁ,M.: The paper presents information on character, activity and extent of Solanum genus gene bank, maintained in an in vitro culture at Potato Research Institute Havlíčkův Brod. Long-term maintenance technique consists in induction of microtuber formation on modified MS media free of plant growth regulators and cultivation at 10 0C and 10 h photoperiod. Subculture is carried out after 10-14 months using chitting microtubers. At present, the gene bank comprises 1547 potato accessions. Potato Research Institute Havlíčkův Brod has been long-termly engaged in accumulation, study and maintenance of potato genetic resources in the Czech Republic. Its activity in this area started in 1952. More than 1800 potato varieties have been successively accumulated and evaluated. Since 1994 the problems of potato genepool have been studied as a part of “National Programme of Conservation and Utilization of Plant Genepool”. Potato gene resources maintenance via simple transplanting of tuber samples exposed the collection to natural infection pressure every year and this resulted in deterioration of health state and in losses of stocks. For this reason, conventional technique of vegetative propagation has been gradually replaced by maintenance in an in vitro culture since 1986. In course of gene bank establishment, the whole series of experiments were carried out directed to observing the influence of culture conditions on retardation of culture growth and induction of in vitro tuberization. Based on these experiments in vitro long-term maitenance has been elaborated. It consists of several joint procedures - quarantine planting of newly obtained materials, - aseptic transfer to in vitro conditions, - in vitro long-term maintaining and subculturing, - in vitro recovery from virus diseases. Both Czech and foreign potato varieties are collected in gene bank and this collection is most numerous maintained group. At present, the collection contains 981 varieties. From the health state point of view, we can divide maintained collection into 3 groups, namely varieties free of virus infection (47,6 %), varieties with PVS infection (26,0 %) and varieties infested by other viruses (26,4 %). The important part of gene bank is the collection of original varieties of Czech breeding, in which 83 out of 100 varieties so far registered in the Czech Republic have been successfully maintained. Based on the requirements of gene bank users, qualitative change in the composition of maintained genotypes was done in 1989. Six subcollections were gradually set up according to the character of maintained stock (subcollections of varieties, tetraploid hybrids, dihaploids, cultivated and wild species and their hybrids). Users of an in vitro potato gene bank are long-term practical potato breeders. After enlarging the collection on new materials of broader spectrum of origin and ploidy level, interest of users from colleges and research workplaces was arisen. Survey of accessions provided from potato gene pool collection in previous years is given in Table I. In accordance with the world collection, progress applied in our in vitro gene bank is characterized by its simplicity in culture establishment, usability for broad spectrum of genotypes and by ability to preserve genetic homogenity and identity of conserved stocks. Decreasing cultivation temperature reduced frequency of mitoses at certain time interval and along with use of media free of plant growth regulators significantly decreases probability of induction of mutations in consequence of long-term maintenance. Evaluating genetic stability in in vitro propagated progeny, equally with results of R o c a et al. (1978) we did not determine deviation greater than in common type of vegetative propagation. Long-term maintenance of potato accessions by induction of in vitro tuberization is widely broaden progress, for dormant microtubers and consecutive chitted shoots being essentially only part of culture able to survive more than 12 months without subculturing on new media. Culture development depends on genotype and on composition of culture medium (W e s t c o t t, 1981), which was also demonstrated in conditions of our gene bank. potato; gene bank; in vitro conservation Contact: Martin, P.A.W. - Schroder, R.F.W. - Poprawski, T.J. Lipa, J.J. - Sosnowska, D. - Hausvater, E. - Rasocha , V.: Beauveria bassiana is the fungus with broad insecticidal activity spectrum. As a biological control agent used against Colorado potato beetles, this fungus has performed erratically in various field studies. This inconsistent performance has been attributed to formulation problems in biopesticides, UV sensitivity, and humidity. In tests carried out in three countries in 1996, B. bassiana controlled Colorado potato beetle larvae in both Poland and the Czech Republic, but not in Maryland. Control was measured by reduction in populations of beetle larvae. One of the major differences among these sites was temperature. In Poland, the mean temperature ranged from 5 °C to 23 °C; in the Czech Republic the mean temperature ranged from 6.7 °C to 18.7 °C; and in Maryland, temperatures at time of application exceeded 45 °C at canopy level. This fact led us to examine B. bassiana growth in vitro. While B. bassiana grew in the laboratory from 16-30 °C, the B. bassiana from a formulated product (MycotrolTM) did not germinate at temperatures above 37 °C. Germination and subsequent development of this entomopathogenic fungus are factors in the infection and control of the Colorado potato beetle. As a consequence of the inability to germinate at high temperatures, B. bassiana would not be expected to effectively control pest insects in climates with hot summers. However, this fungus may be suitable for insect control in early spring or in cool temperature climates during the growing season. biocontrol fungi, Beauveria bassiana, Leptinotarsa decemlineata Contact: MATOUŠEK, J. - VRBA, L. - JUNKER, V. - SCHRÖDER, A. - STEGER, G. - RIESNER, D.: Antisense RNA genes targeted against putative PSTVd promoter element, which forms the structure of hairpin II, were constructed on the basis of 7SL RNA and tRNA vehicles. Both these vehicles are driven by RNA polymerase III. Anti-hairpin II antisense RNA was shown in our experiments to bind specifically to hairpin II formed on minus viroid replication intermediates during hybridization and also at physiological temperature conditions during pre-transcription. A complete 7SL RNA gene containing both, promoter and terminator elements was isolated from Arabidopsis thaliana and modified by inserting a 31 bp polylinker sequence upstream of the conserved motif ACCA at the 3' end of the gene. The flanking restriction sites were added to 7SL RNA gene to facilitate cloning in plant expression vectors. A 27-base anti-hairpin II sequence (5'CCTACTCGCTCCCTTTGCGCTGTCGCT3') was inserted in the SrfI cloning site of modified 7SL gene. Structural features of this RNA chimera were analyzed by computer calculations. Anti-hairpin II sequence was predicted to form a part of distinct hairpin loop within the 7SL RNA structure and should be thus accessible for pairing with the target sequence. tRNA chimeras were also constructed by modification of a tRNATyr gene. The anti-hairpin loop II sequence carried an extension of nine and ten C residues on its 5' and 3' end, respectively, replaced the natural tRNA intron in this gene. Oligo C extension should facilitate interaction of tRNA chimeras with the target viroid sequence. Both, 7SL RNA and tRNA antisense cassettes were assayed for in vitro transcription using RNA polymerase III extract from HeLa cells. Strong in vitro transcription of these antisense RNAs was achieved. Plant expression vectors containing anti-HPII genes were constructed and are available for the preparation of potato transgenotes. viroid; hairpin II; antisense RNA; RNA polymerase III Contact: PŘICHYSTALOVÁ-FIALKOVÁ,V.-ZRŮST,J.-HLUŠEK,J:-JŮZL,M.: In the years 1995 to 1997 field trial was carried out to study varietal differences in a-chaconine and a-solanine contents in raw unpeeled tubers of four very early potato varieties (Krystala, Koruna, Impala, Ukama). Two localities with different nitrogen fertilization were used in the trial. The greatest differences in glycoalkaloid content (GAs) were determined among localities, followed by years, varieties and nitrogen level. Highly significant differences were recorded for both glycoalkaloids (a-chaconine and a-solanine) in all observed indices (among localities, years, varieties, N levels) in evaluation of individual years. Several year averages were close to each other as regard as varieties and N level and significance of a-chaconine and total tuber glycoalkaloids was not determined. Averaged over three years both Dutch potato varieties non-significantly differed from Czech varieties regarding their higher content of a-chaconine and total tuber glycoalkaloids (Tabs. I and III). Ukama had the highest content of a-solanine and Impala had the lowest one (Tab. II) of four varieties used in the trial. In all three experimental years, content of glycoalkaloids predominated, namely highly significant, at the Valečov locality, compared to results from Žabčice (Figs. 1-3). In these trials, we also determined significant differences between localities in tuber content of heavy metals. Tubers from Valečov were characterized by significantly lower contents of Cd, Ni, Zn (H l u š e k et al., 1997), Mn and Cu (H l u š e k et al., 1998) than tubers from Žabčice locality. Nitrogen level raised from 60 kg to 120 kg.ha-1 resulted in highly significant increase in glycoalkaloid content during individual years. However, opposite trend was also recorded in many cases (Figs. 1-3). The lowest GA content was measured in 1997, i.e. the year when no greater rainfall shortage occured during growing period of very early potato varieties and temperatures were not above-average during growth. Content of total tuber glycoalkaloids reached not even a half of acceptable limit set by the Decree of the Ministry of Health of the Czech Republic, i.e. 200 mg.kg-1 (fresh weight). From both most important glycoalkaloids, a-chaconine had higher content in all varieties. Ratio of a-solanine and a-chaconine contents ranged from 1,2 to 1,9 and differed among localities, individual years as well as among N levels. very early potato varieties; a-chaconine; a-solanine; locality; year; N level; HPLC Contact: PTÁČEK, J. - MATOUŠEK, J. - DĚDIČ, P.: Isolates of PVS originating from different countries were examined by using molecular diagnosis by RT-PCR and cDNA hybridization. In the course of RT-PCR evaluation five methods for nucleic acid preparation from tomato leaves were compared. Two methods (extraction of total RNA by QIAGEN kit and immunocapture technique) yielded most reliable and reproducable results and were also suitable for large-scale application. Utilizing specific primer combinations derived from coat protein region (CP) and devised by H e l d á k (1996) and M a t o u š e k et al. (1998), it was possible to detect all the isolates tested. We used successfuly our radioactively (32P) (Amersham) and nonradioactively labeled (DIG) (Boehringer) cDNA probe for molecular hybridization with PVS extracts and/or RT-PCR products. potatoes; potato virus S; detection; molecular diagnosis Contact: Rasocha, V. - Hausvater , E.: Results of potato retardation with chemicals Neo-Stop and Luxan. Vědecké práce/Scientific Studies - Výzkumný ústav bramborářský Havlíčkův Brod, 13, 1999, 113-122 In the exact laboratory and semi-practice trials during 1997 and 1998 the retardation efficacy on potato tubers was evaluated using chemicals Neo-Stop and Luxan. Both chemicals and their formulations indicated very good retardation efficacy. The results could be summarized as follows:
potatoes; retardation; Neo-Stop; Luxan; losses by respiration; losses by sprouting Contact: VOKÁL, B. - HAMOUZ, K. - ČEPL, J.: There was the tradition in the Czech Republic that decisive potato growing area was concentrated in agricultural potato growing production region (BVO). The first early potatoes for tablestock use were particularly grown in warmer and more yielding regions (mainly in beet growing production region - ŘVO). There were many reasons for this condition. Climatological factors, referred to better fulfil the requirements of potatoes in BVO, were counted among the most important factors. Regions suitable for growing of potatoes are associated with following daily mean temperature and rainfalls in decisive months:
Compared with data (normal) obtained from ŘVO and BVO (Tab. 1) it is evident that from the standpoint of temperature, data correspond more to the reality of ŘVO. In general, lower values of rainfalls were determined in ŘVO, but it can not be claimed that actual values of BVO come near mentioned ones unambiguously. In 1995 – 1997 influence of different ecological conditions of BVO (moister, colder, lower yielding) and ŘVO (drier, warmer, more yielding) on tuber yield (Tab.2), cooking quality (Tabs. 3-6) and its most important components (tuber appearance, odour, flavour and swallowness, tuber dry matter content (Tab.7) and storage losses (Tab.8) was investigated. Observation was done on samples of seven varieties (5 varieties in 1995) obtained with uniform agricultural practices at 12 localities. On average, favourable influence of BVO on tuber yield (+ 17,7 %) was determined. Tendency for higher level of total cooking quality (by 5,1 %), tuber appearance after cooking (by 13,0 %), flavour and swallowness (by 2,4 %) was verified in ŘVO. Production region did practically not influence flavour and tuber dry matter content (only 0,8 % in favour of beet growing region). Larger storage losses (by 9,7 %) were recorded for tubers grown in beet growing region. Our work also resulted in the fact that current determination of optimum course of temperature and rainfalls for growth and tuber development is not precise and it requires more accuracy. potatoes; agricultural production regions; tuber yield; cooking quality; dry matter content; storage losses Contact: ZRŮST, J. – JŮZL, M. – HLUŠEK, J. – PŘICHYSTALOVÁ, V. : In the field trial established in 1994 and 1997 with 4 very early potato varieties (Impala, Ukama, Krystala, Koruna), yield-forming components contributing to yield formation: number of stems per area unit - as calculated per hill, number of tubers per stem and average weight of a single tuber were evaluated. Observation on varietal differences was carried out at 2 localities (under conditions of the Bohemian-Moravian Highland at Research Station Valečov near Havlíčkův Brod - 460 m of altitude and in the Southern Moravia at locality Žabčice near Brno - 184 m of altitude) with different N fertilization (60 and 120 kg.ha-1). Raw spacing was equal at both localities, namely 750 x 250 mm, i.e. 5,334 hills per m2. Due to different weather at both localities, evaluation of each one was done separately (Tab. I). Number of stems per area unit or as calculated per plant differed at both localities and individual varieties (Tab. II). Stem number of all varieties was on average higher at Valečov, on contrary, differences among varieties were larger at Žabčice (highly significant). On average of all years potato seed was stored at lower tempeatures in Valečov, which made presupposition for formation of more stems per area (by breaking the apical dominance). From yield-forming components, differences among varieties were the smallest as regard as number of tubers per stem. From both localities, higher number of tubers per stem was recorded for Valečov locality (Tab. III). The ranking order of varieties differed at both localities. Besides number of tubers per stem, number of stems per hill is important as well. Certain compensation in tuber number occurs with competition among stems. Weight differences of single (average) tuber between varieties were much greater at Valečov than at Žabčice (Tab. III). We suppose that conditions of Bohemian-Moravian Highland, which resemble conditions of South American centres, where cultivated potatoes originate in, better fulfiled crop requirements for environment, in which higher productivity of individual varieties was realized more during the whole growing period. Higher formation of tuber yield was also achieved at Valečov (Tab. IV). The trials with selected 4 very early potato varieties confirmed our previous findings (Z r ů s t, 1988) that varieties with lower number of stems, intermediate and higher tuber iniciation per stem, with higher weight of single tuber (previously e.g. Resy and Ostara) indicated to be the most yielding very early potato varieties. With early tuber iniciation, these varieties are able to give high yields not even at first harvest dates, but also at later ones. Compared with results from Tab. V, within the four-year average (1986-89), varieties Ostara and Resy achieved following values of yield-forming components: X = 4,11 and 4,21, Y = 2,91 and 3,17, Z = 74,06 and 67,79 g and W = 873,10 g and 862,15 g (Z r ů s t, 1991b). Impala with the highest yield at Valečov and Žabčice formed yield by/with the highest average tuber weight (of 4 varieties) at both localities and in the conditions of the Bohemian-Moravian Highland at Valečov also with the highest tuber number per area unit, in the Southern Moravia (Žabčice locality) also the highest number of tubers per stem. Other varieties at Valečov formed yield from yield-forming components particularly with number of stem and average tuber weight. Regarding yield-forming components, ranking order of varieties was equal as in total yield (Ukama, Koruna, Krystala). At Žabčice locality, Krystala had the highest stem number of all varieties and this was ranked after Impala as regard as weight of a single tuber. Ukama, which had the third highest yield, particularly formed yield with higher stem number than Koruna, which had the lowest yield. Yield-forming components and also total yield were influenced by distribution and quantity of rainfalls in individual years. Increased N level was positively reflected in the value of yield-forming components at both localities, most in weight of average tuber and in total yield as well. very early potato varieties, yield-forming components, number of stems per area unit, number of stems per plant, number of tubers per stem, mean weight of tuber, N level, influence of weather, locality Contact: |
|
| ||||||||